Functional differentiation of the glycosyltransferases that contribute to the chemical diversity of bioactive flavonol glycosides in grapevines (Vitis vinifera).

Functional differentiation of the glycosyltransferases that contribute to the chemical diversity of bioactive flavonol glycosides in grapevines (Vitis vinifera).

Posted on by Mathew

We recognized two glycosyltransferases that contribute to the structural diversification of flavonol glycosides in grapevine (Vitis vinifera): glycosyltransferase 5 (Vv GT5) and Vv GT6. Biochemical analyses confirmed that Vv GT5 is a UDP-glucuronic acid:flavonol-3-O-glucuronosyltransferase (GAT), and Vv GT6 is a bifunctional UDP-glucose/UDP-galactose:flavonol-3-O-glucosyltransferase/galactosyltransferase.

The Vv GT5 and Vv GT6 genes have very excessive sequence similarity (91%) and are positioned in tandem on chromosome 11, suggesting that one of these genes arose from the different by gene duplication. Both of these enzymes had been expressed in accordance with flavonol synthase gene expression and flavonoid distribution patterns in this plant, corroborating their significance in flavonol glycoside biosynthesis.

The determinant of the specificity of Vv GT5 for UDP-glucuronic acid was discovered to be Arg-140, which corresponded to none of the determinants beforehand recognized for different plant GATs in major buildings, offering one other instance of convergent evolution of plant GAT. We additionally analyzed the determinants of the sugar donor specificity of Vv GT6.

Gln-373 and Pro-19 had been discovered to play necessary roles in the bifunctional specificity of the enzyme. The outcomes introduced right here recommend that the sugar donor specificities of these Vv GTs might be decided by a restricted quantity of amino acid substitutions in the major buildings of protein duplicates, illustrating the plasticity of plant glycosyltransferases in buying new sugar donor specificities.

Regression analyses indicated no direct relationship between photosynthesis and leaf ranges of UV-B-absorbing compounds. UV-B radiation elevated photosynthetic pigment content material, together with UV-B-absorbing compounds, however solely the former (particularly carotenoids) was associated to complete biomass (r2 = 0.61, linear) and to photosynthetic effectivity (unfavorable, exponential relationship, r2 = 0.82). A discount in photosynthesis was related primarily with a stomatal limitation somewhat than photosystem II harm.

This research suggests that each carotenoids and flavonoids could also be concerned in plant UV-B photoprotection, however solely carotenoids are instantly linked to photoprotection of photosynthetic operate. These outcomes moreover present the significance of UV-A management in UV-B experiments carried out utilizing synthetic lamps and filters.

Central nervous system depressant motion of flavonoid glycosides.

The pharmacological results on the central nervous system (CNS) of a variety of obtainable flavonoid glycosides had been explored and in contrast to these of the glycosides 2S-hesperidin and linarin, just lately remoted from valeriana. The glycosides 2S-neohesperidin, 2S-naringin, diosmin, gossipyn and rutin exerted a depressant motion on the CNS of mice following i.p. injection, related to that discovered with 2S-hesperidin and linarin.

We display in this work that these behavioural actions, as measured in the gap board, thiopental induced sleeping time and locomotor exercise checks, are unlikely to contain a direct motion on gamma-aminobutyric acid sort A (GABA(A)) receptors. The corresponding aglycones had been inactive, pointing to the significance of the sugar moieties in the glycosides in their CNS depressant motion following systemic administration.

The pharmacological properties of the flavonoid glycosides studied right here, in addition to our earlier outcomes with hesperidin and linarin, opens a promising new avenue of analysis in the subject. Aeruginosins symbolize a bunch of peptide metabolites remoted from varied cyanobacterial genera and from marine sponges that potently inhibit differing types of serine proteases.

Functional differentiation of the glycosyltransferases that contribute to the chemical diversity of bioactive flavonol glycosides in grapevines (Vitis vinifera).

Members of this household are characterised by the presence of a 2-carboxy-6-hydroxyoctahydroindole (Choi) moiety. We have recognized and absolutely sequenced a NRPS gene cluster in the genome of the cyanobacterium Planktothrix agardhii CYA126/8. Insertional mutagenesis of a NRPS element led to the discovery and structural elucidation of two glycopeptides that had been designated aeruginoside 126A and aeruginoside 126B.

One variant of the aglycone incorporates a 1-amino-2-(N-amidino-Delta(3)-pyrrolinyl)ethyl moiety at the C terminus, the different bears an agmatine residue. In silico analyses of the aeruginoside biosynthetic genes aerA-aerI in addition to extra mutagenesis and feeding research allowed the prediction of enzymatic steps main to the formation of aeruginosides and the uncommon Choi moiety.

Bioavailability of the flavanone naringenin and its glycosides in rats.

Naringenin, the predominant flavanone in grapefruit, primarily happens as glycosides akin to naringenin-7- rhamnoglucoside or naringenin-7-glucoside. This research in contrast kinetics of absorption of naringenin and its glycosides in rats both after a single flavanone-containing meal or after adaptation to a weight loss program for 14 days.

Regardless of the weight loss program, circulating metabolites had been glucurono- and sulfoconjugated derivatives of naringenin. The kinetics of absorption of naringenin and naringenin-7-glucoside had been related, whereas naringenin-7-rhamnoglucoside exhibited a delay in its intestinal absorption, ensuing in decreased bioavailability.

After naringenin-7-glucoside feeding, no glucoside was discovered in the cecum. However, after feeding naringenin-7-rhamnoglucoside, some naringenin-7-rhamnoglucoside gathered in cecum earlier than being hydrolyzed by intestinal microflora. Adaptation to flavanone diets didn’t induce accumulation of plasma naringenin.

Moreover, flavanone cecal content material markedly decreased after adaptation, and nearly no naringenin-7-rhamnoglucoside was recovered after naringenin-7-rhamnoglucoside feeding, suggesting that an adaptation of cecal microflora had occurred. Overall, these information point out that flavanones are effectively absorbed after feeding to rats and that their bioavailability is said to their glycosidic moiety.

This outcomes in half from the design of UV-B experiments in which experimental UV-A irradiance has not been rigorously managed, since blue/UV-A radiation is concerned in the biosynthesis of the photosynthetic pigments. The relationship of flavonoids to photosynthetic efficiency, photosynthetic pigments, and progress measures was examined in an experiment the place UV-A management teams had been included at two biologically efficient every day UV-B irradiances, 14.1 and 10.7 kJ m-2.

Mouse Protectin (CD59) ELISA Kit
DLR-CD59-Mu-96T 96T
EUR 661
  • Should the Mouse Protectin (CD59) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Protectin (CD59) in samples from serum, plasma, urine or other biological fluids.

Human Protectin (CD59) ELISA Kit
RD-CD59-Hu-48Tests 48 Tests
EUR 500

Human Protectin (CD59) ELISA Kit
RD-CD59-Hu-96Tests 96 Tests
EUR 692

Mouse Protectin (CD59) ELISA Kit
RD-CD59-Mu-48Tests 48 Tests
EUR 511

Mouse Protectin (CD59) ELISA Kit
RD-CD59-Mu-96Tests 96 Tests
EUR 709

Human Protectin (CD59) ELISA Kit
RDR-CD59-Hu-48Tests 48 Tests
EUR 522

Human Protectin (CD59) ELISA Kit
RDR-CD59-Hu-96Tests 96 Tests
EUR 724

Mouse Protectin (CD59) ELISA Kit
RDR-CD59-Mu-48Tests 48 Tests
EUR 534

Mouse Protectin (CD59) ELISA Kit
RDR-CD59-Mu-96Tests 96 Tests
EUR 742

Mouse Monoclonal Anti-Human CD59, (Biotin) (Clone 1F5) (mouse IgG1)
CD59-B 25 tests
EUR 408

Mouse Monoclonal Anti-Human CD59, (FITC) (Clone 1F5) (mouse IgG1)
CD59-F 25 tests
EUR 408

Mouse Monoclonal Anti-Human CD59, (PE) (Clone 1F5) (mouse IgG1)
CD59-PE 25 tests
EUR 408

Pig CD59 Glycoprotein (CD59) ELISA Kit
abx519457-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Monkey CD59 Glycoprotein (CD59) ELISA Kit
abx360041-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Pig CD59 Glycoprotein (CD59) ELISA Kit
abx361750-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Rabbit CD59 Glycoprotein (CD59) ELISA Kit
abx362655-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Human CD59 Glycoprotein (CD59) ELISA Kit
abx575604-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.

Human CD59/ CD59 glycoprotein ELISA Kit
E0432Hu 1 Kit
EUR 571

Goat CD59 glycoprotein(CD59) ELISA kit
E06C1490-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat CD59 glycoprotein(CD59) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat CD59 glycoprotein(CD59) ELISA kit
E06C1490-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat CD59 glycoprotein(CD59) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat CD59 glycoprotein(CD59) ELISA kit
E06C1490-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat CD59 glycoprotein(CD59) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat CD59 glycoprotein(CD59) ELISA kit
E02C1490-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat CD59 glycoprotein(CD59) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat CD59 glycoprotein(CD59) ELISA kit
E02C1490-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat CD59 glycoprotein(CD59) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat CD59 glycoprotein(CD59) ELISA kit
E02C1490-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat CD59 glycoprotein(CD59) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse CD59 glycoprotein(CD59) ELISA kit
E03C1490-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse CD59 glycoprotein(CD59) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse CD59 glycoprotein(CD59) ELISA kit
E03C1490-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse CD59 glycoprotein(CD59) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse CD59 glycoprotein(CD59) ELISA kit
E03C1490-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse CD59 glycoprotein(CD59) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit CD59 glycoprotein(CD59) ELISA kit
E04C1490-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit CD59 glycoprotein(CD59) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit CD59 glycoprotein(CD59) ELISA kit
E04C1490-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit CD59 glycoprotein(CD59) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit CD59 glycoprotein(CD59) ELISA kit
E04C1490-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit CD59 glycoprotein(CD59) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human CD59 glycoprotein(CD59) ELISA kit
E01C1490-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human CD59 glycoprotein(CD59) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human CD59 glycoprotein(CD59) ELISA kit
E01C1490-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human CD59 glycoprotein(CD59) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human CD59 glycoprotein(CD59) ELISA kit
E01C1490-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human CD59 glycoprotein(CD59) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig CD59 glycoprotein(CD59) ELISA kit
E07C1490-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine CD59 glycoprotein(CD59) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig CD59 glycoprotein(CD59) ELISA kit
E07C1490-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine CD59 glycoprotein(CD59) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig CD59 glycoprotein(CD59) ELISA kit
E07C1490-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine CD59 glycoprotein(CD59) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog CD59 glycoprotein(CD59) ELISA kit
E08C1490-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine CD59 glycoprotein(CD59) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog CD59 glycoprotein(CD59) ELISA kit
E08C1490-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine CD59 glycoprotein(CD59) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog CD59 glycoprotein(CD59) ELISA kit
E08C1490-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine CD59 glycoprotein(CD59) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey CD59 glycoprotein(CD59) ELISA kit
E09C1490-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey CD59 glycoprotein(CD59) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey CD59 glycoprotein(CD59) ELISA kit
E09C1490-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey CD59 glycoprotein(CD59) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey CD59 glycoprotein(CD59) ELISA kit
E09C1490-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey CD59 glycoprotein(CD59) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human CD59(CD59 glycoprotein) ELISA Kit
EH2112 96T
EUR 524.1
  • Detection range: 31.25-2000 pg/ml
  • Uniprot ID: P13987
  • Alias: CD59/HRF20/MACIF/MIC11/Protectin/16.3A5/1F5/1F5 antigen/20 kDa homologous restriction factor/CD59 antigen/CD59 antigen p18-20(antigen identified by monoclonal antibodies 16.3A5, EJ16/CD59 an
  • Show more
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 18.75pg/ml

Rat CD59 glycoprotein, Cd59 ELISA KIT
ELI-06795r 96 Tests
EUR 886

Human CD59 glycoprotein, CD59 ELISA KIT
ELI-06797h 96 Tests
EUR 824

Rabbit CD59 glycoprotein, CD59 ELISA KIT
ELI-06798Ra 96 Tests
EUR 928

Porcine CD59 glycoprotein, CD59 ELISA KIT
ELI-06799p 96 Tests
EUR 928

Rat Cd59(CD59 glycoprotein) ELISA Kit
ER0635 96T
EUR 567.6
  • Detection range: 0.156-10 ng/ml
  • Uniprot ID: P27274
  • Alias: Cd59/HRF20/MACIF/MIC11/Protectin/16.3A5/1F5/1F5 antigen/20 kDa homologous restriction factor/CD59 antigen/CD59 antigen p18-20(antigen identified by monoclonal antibodies 16.3A5, EJ16/CD59 anti
  • Show more
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Rattus;Sensitivity: 0.094 ng/ml

Mouse CD59 Glycoprotein (CD59) ELISA Kit
20-abx154584
  • EUR 7237.00
  • EUR 3855.00
  • EUR 895.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human CD59 Glycoprotein (CD59) ELISA Kit
20-abx152853
  • EUR 7112.00
  • EUR 3792.00
  • EUR 879.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Chicken CD59 Glycoprotein (CD59) ELISA Kit
abx356537-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Rat CD59 Glycoprotein (CD59) ELISA Kit
abx256610-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Human CD59 Glycoprotein (CD59) ELISA Kit
abx251445-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.

Human CD59 glycoprotein(CD59) ELISA kit
CSB-EL004947HU-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human CD59 glycoprotein (CD59) in samples from serum, plasma, tissue homogenates, urine. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human CD59 glycoprotein(CD59) ELISA kit
1-CSB-EL004947HU
  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human CD59 glycoprotein(CD59) in samples from serum, plasma, tissue homogenates, urine. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Rat Cd59/ CD59 glycoprotein ELISA Kit
E0182Ra 1 Kit
EUR 571

Human CD59 glycoprotein (CD59)
1-CSB-YP004947HU
  • EUR 430.00
  • EUR 234.00
  • EUR 1508.00
  • EUR 642.00
  • EUR 1009.00
  • EUR 291.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 11 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human CD59 glycoprotein(CD59) expressed in Yeast

Human CD59 glycoprotein (CD59)
1-CSB-EP004947HU
  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 36 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human CD59 glycoprotein(CD59) expressed in E.coli

Guinea pig CD59 glycoprotein(CD59) ELISA kit
E05C1490-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig CD59 glycoprotein(CD59) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig CD59 glycoprotein(CD59) ELISA kit
E05C1490-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig CD59 glycoprotein(CD59) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig CD59 glycoprotein(CD59) ELISA kit
E05C1490-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig CD59 glycoprotein(CD59) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig CD59 Glycoprotein (CD59) ELISA Kit
abx357782-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Cd59 ELISA Kit| Rat CD59 glycoprotein ELISA Kit
EF017452 96 Tests
EUR 689

CD59 glycoprotein Polyclonal Antibody
42110-100ul 100ul
EUR 333

ELISA kit for Human CD59 glycoprotein
EK4299 96 tests
EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human CD59 glycoprotein in samples from serum, plasma, tissue homogenates and other biological fluids.

ELISA kit for Rat CD59 glycoprotein
EK4301 96 tests
EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Rat CD59 glycoprotein in samples from serum, plasma, tissue homogenates and other biological fluids.

CD59
59A-100T 100 test
EUR 349

CD59
59B-01MG 100 test
EUR 284

CD59
59CFB-100T 100 test
EUR 388

CD59
59F-100T 100 test
EUR 297

CD59
59PE-100T 100 test
EUR 362

CD59
59PE1-100T 100 test
EUR 453

CD59
59PP-100T 100 test
EUR 349

CD59
59PU-01MG 0,1 mg
EUR 219

Human CD59 ELISA Kit
EHP0359 96Tests
EUR 521

Human CD59 ELISA Kit
ELA-E2116h 96 Tests
EUR 824

Goat CD59 ELISA Kit
EGTP0359 96Tests
EUR 521

Bovine CD59 ELISA Kit
EBP0359 96Tests
EUR 521

Anserini CD59 ELISA Kit
EAP0359 96Tests
EUR 521

Canine CD59 ELISA Kit
ECP0359 96Tests
EUR 521

CD59 ELISA KIT|Human
EF006190 96 Tests
EUR 689

Porcine CD59 ELISA Kit
EPP0359 96Tests
EUR 521

Rat CD59 ELISA Kit
ERP0359 96Tests
EUR 521

Rabbit CD59 ELISA Kit
ERTP0359 96Tests
EUR 521

Monkey CD59 ELISA Kit
EMKP0359 96Tests
EUR 521

Mouse CD59 ELISA Kit
EMP0359 96Tests
EUR 521

CD59 Antibody
BF0017 200ul
EUR 376
Description: CD59 antibody detects endogenous levels of total CD59.

CD59 Protein
20-abx263374
  • EUR 1609.00
  • EUR 328.00
  • EUR 230.00
  • 100 ug
  • 10 ug
  • 2 µg
  • Shipped within 5-10 working days.

CD59 siRNA
20-abx911052
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CD59 siRNA
20-abx911053
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CD59 Antibody
ABD2303 100 ug
EUR 438

CD59 Antibody
ABD6557 100 ug
EUR 438

CD59 Antibody
49441-100ul 100ul
EUR 333

CD59 Antibody
49441-50ul 50ul
EUR 239

CD59 antibody
10C-CR2040M1 100 ug
EUR 339
Description: Mouse monoclonal CD59 antibody

CD59 Antibody
32388-100ul 100ul
EUR 252

CD59 antibody
70R-16284 50 ul
EUR 435
Description: Rabbit polyclonal CD59 antibody

CD59 Antibody
DF6557 200ul
EUR 304
Description: CD59 Antibody detects endogenous levels of total CD59.

CD59 Antibody
DF2303 200ul
EUR 304
Description: CD59 antibody detects endogenous levels of total CD59.

CD59 Antibody
1-CSB-PA004947EA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CD59. Recognizes CD59 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

CD59 Antibody
1-CSB-PA004947GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against CD59. Recognizes CD59 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

CD59 Antibody
1-CSB-PA004947YA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CD59. Recognizes CD59 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

CD59 Antibody
1-CSB-PA005228
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against CD59. Recognizes CD59 from Human. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/20000

CD59 Antibody
1-CSB-PA778176
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against CD59. Recognizes CD59 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:10000, WB:1:500-1:2000, IHC:1:100-1:300

CD59 Antibody
1-CSB-PA569443
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against CD59. Recognizes CD59 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:5000, IHC:1:25-1:100

anti-CD59
YF-PA10808 50 ug
EUR 363
Description: Mouse polyclonal to CD59

anti-CD59
YF-PA10810 100 ug
EUR 403
Description: Rabbit polyclonal to CD59

Guinea Pig CD59 ELISA Kit
EGP0359 96Tests
EUR 521

Human Protectin (CD59) ELISA Kit
SEB336Hu-10x96wellstestplate 10x96-wells test plate
EUR 4502.43
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Protectin (CD59) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Protectin (CD59) in serum, plasma, cell lysates and other biological fluids.

Human Protectin (CD59) ELISA Kit
SEB336Hu-1x48wellstestplate 1x48-wells test plate
EUR 458.44
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Protectin (CD59) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Protectin (CD59) in serum, plasma, cell lysates and other biological fluids.

Human Protectin (CD59) ELISA Kit
SEB336Hu-1x96wellstestplate 1x96-wells test plate
EUR 612.05
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Protectin (CD59) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Protectin (CD59) in serum, plasma, cell lysates and other biological fluids.

Human Protectin (CD59) ELISA Kit
SEB336Hu-5x96wellstestplate 5x96-wells test plate
EUR 2454.23
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Protectin (CD59) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Protectin (CD59) in serum, plasma, cell lysates and other biological fluids.

Human Protectin (CD59) ELISA Kit
4-SEB336Hu
  • EUR 4553.00
  • EUR 2405.00
  • EUR 613.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Protectin elisa. Alternative names of the recognized antigen: MIC11
  • MIN1
  • MIN2
  • MIN3
  • MSK21
  • MAC-IP
  • MACIF
  • MIRL
  • HRF20
  • Complement Regulatory Protein
  • 20 kDa homologous restriction factor
  • Membrane attack complex inhibition factor
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Protectin (CD59) in samples from Serum, plasma, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Mouse Protectin (CD59) ELISA Kit
SEB336Mu-10x96wellstestplate 10x96-wells test plate
EUR 4626.78
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Protectin (CD59) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Protectin (CD59) in serum, plasma, urine and other biological fluids.

Mouse Protectin (CD59) ELISA Kit
SEB336Mu-1x48wellstestplate 1x48-wells test plate
EUR 468.68
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Protectin (CD59) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Protectin (CD59) in serum, plasma, urine and other biological fluids.

Mouse Protectin (CD59) ELISA Kit
SEB336Mu-1x96wellstestplate 1x96-wells test plate
EUR 626.68
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Protectin (CD59) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Protectin (CD59) in serum, plasma, urine and other biological fluids.

Mouse Protectin (CD59) ELISA Kit
SEB336Mu-5x96wellstestplate 5x96-wells test plate
EUR 2520.06
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Protectin (CD59) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Protectin (CD59) in serum, plasma, urine and other biological fluids.

Mouse Protectin (CD59) ELISA Kit
4-SEB336Mu
  • EUR 4677.00
  • EUR 2471.00
  • EUR 627.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Protectin elisa. Alternative names of the recognized antigen: MIC11
  • MIN1
  • MIN2
  • MIN3
  • MSK21
  • MAC-IP
  • MACIF
  • MIRL
  • HRF20
  • Complement Regulatory Protein
  • 20 kDa homologous restriction factor
  • Membrane attack complex inhibition factor
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Protectin (CD59) in samples from Serum, plasma, urine and other biological fluids. with no significant corss-reactivity with analogues from other species.

Human Protectin ELISA Kit (CD59)
RK01072 96 Tests
EUR 521

CD59 ELISA Kit (Human) (OKAN05355)
OKAN05355 96 Wells
EUR 792
Description: Description of target: This gene encodes a cell surface glycoprotein that regulates complement-mediated cell lysis, and it is involved in lymphocyte signal transduction. This protein is a potent inhibitor of the complement membrane attack complex, whereby it binds complement C8 and/or C9 during the assembly of this complex, thereby inhibiting the incorporation of multiple copies of C9 into the complex, which is necessary for osmolytic pore formation. This protein also plays a role in signal transduction pathways in the activation of T cells. Mutations in this gene cause CD59 deficiency, a disease resulting in hemolytic anemia and thrombosis, and which causes cerebral infarction. Multiple alternatively spliced transcript variants, which encode the same protein, have been identified for this gene.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 5.5 pg/mL

CD59 ELISA Kit (Human) (OKCD07331)
OKCD07331 96 Wells
EUR 936
Description: Description of target: This gene encodes a cell surface glycoprotein that regulates complement-mediated cell lysis, and it is involved in lymphocyte signal transduction. This protein is a potent inhibitor of the complement membrane attack complex, whereby it binds complement C8 and/or C9 during the assembly of this complex, thereby inhibiting the incorporation of multiple copies of C9 into the complex, which is necessary for osmolytic pore formation. This protein also plays a role in signal transduction pathways in the activation of T cells. Mutations in this gene cause CD59 deficiency, a disease resulting in hemolytic anemia and thrombosis, and which causes cerebral infarction. Multiple alternatively spliced transcript variants, which encode the same protein, have been identified for this gene.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 5.5pg/mL

Monoclonal CD59 Antibody
AMRa00012G 0.05mg
EUR 484
Description: A Monoclonal antibody against Human CD59. The antibodies are raised in Rat. This antibody is applicable in WB and IHC-P, IHC-Fr, Flo

Polyclonal CD59 Antibody
APR06804G 0.1 mg
EUR 659
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human CD59 . This antibody is tested and proven to work in the following applications:

CD59 Blocking Peptide
BF0017-BP 1mg
EUR 195

CD59 cloning plasmid
CSB-CL004947HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 387
  • Sequence: atgggaatccaaggagggtctgtcctgttcgggctgctgctcgtcctggctgtcttctgccattcaggtcatagcctgcagtgctacaactgtcctaacccaactgctgactgcaaaacagccgtcaattgttcatctgattttgatgcgtgtctcattaccaaagctgggttaca
  • Show more
Description: A cloning plasmid for the CD59 gene.

anti- CD59 antibody
FNab01489 100µg
EUR 505.25
  • Immunogen: CD59 molecule, complement regulatory protein
  • Uniprot ID: P13987
  • Gene ID: 966
  • Research Area: Stem Cells, Immunology, Signal Transduction
Description: Antibody raised against CD59

CD59 Polyclonal Antibody
ES3982-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CD59 from Human. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

CD59 Polyclonal Antibody
ES3982-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CD59 from Human. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

Protectin (CD59) Antibody
20-abx111491
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Protectin (CD59) Antibody
20-abx109633
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Protectin (CD59) Antibody
20-abx109634
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

CD59 Polyclonal Antibody
ABP52983-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from the Internal region of human CD59
  • Applications tips:
Description: A polyclonal antibody for detection of CD59 from Human. This CD59 antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human CD59

CD59 Polyclonal Antibody
ABP52983-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from the Internal region of human CD59
  • Applications tips:
Description: A polyclonal antibody for detection of CD59 from Human. This CD59 antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human CD59

CD59 Polyclonal Antibody
ABP52983-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the Internal region of human CD59
  • Applications tips:
Description: A polyclonal antibody for detection of CD59 from Human. This CD59 antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human CD59

Protectin (CD59) Antibody
20-abx001417
  • EUR 411.00
  • EUR 592.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

Protectin (CD59) Antibody
abx139305-01mg 0.1 mg
EUR 356
  • Shipped within 5-12 working days.

Protectin (CD59) Antibody
abx139306-01mg 0.1 mg
EUR 370
  • Shipped within 5-12 working days.

Protectin (CD59) Antibody
abx139307-01mg 0.1 mg
EUR 356
  • Shipped within 5-12 working days.

Protectin (CD59) Antibody
20-abx132385
  • EUR 328.00
  • EUR 843.00
  • EUR 439.00
  • EUR 154.00
  • EUR 258.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-7 working days.

Protectin (CD59) Antibody
abx036096-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Protectin (CD59) Antibody
20-abx100397
  • EUR 411.00
  • EUR 133.00
  • EUR 1149.00
  • EUR 565.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Protectin (CD59) Antibody
20-abx100398
  • EUR 425.00
  • EUR 133.00
  • EUR 1177.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Protectin (CD59) Antibody
20-abx100399
  • EUR 439.00
  • EUR 133.00
  • EUR 1247.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Protectin (CD59) Antibody
20-abx100400
  • EUR 439.00
  • EUR 133.00
  • EUR 1247.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Protectin (CD59) Antibody
20-abx100401
  • EUR 467.00
  • EUR 133.00
  • EUR 1344.00
  • EUR 634.00
  • EUR 356.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Protectin (CD59) Antibody
20-abx100402
  • EUR 481.00
  • EUR 133.00
  • EUR 1442.00
  • EUR 676.00
  • EUR 356.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Protectin (CD59) Antibody
abx011952-100ug 100 ug
EUR 411
  • Shipped within 5-10 working days.

Protectin (CD59) Antibody
abx021467-100ug 100 ug
EUR 453
  • Shipped within 5-10 working days.

Protectin (CD59) Antibody
20-abx174238
  • EUR 815.00
  • EUR 425.00
  • 1 mg
  • 200 ug
  • Please enquire.

Protectin (CD59) Antibody
20-abx178138
  • EUR 425.00
  • EUR 133.00
  • EUR 1177.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Protectin (CD59) Antibody
20-abx323672
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Protectin (CD59) Antibody
20-abx339758
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Protectin (CD59) Antibody
20-abx270064
  • EUR 467.00
  • EUR 537.00
  • EUR 272.00
  • EUR 815.00
  • EUR 356.00
  • 100 tests
  • 200 tests
  • 25 tests
  • 500 tests
  • 50 tests
  • Shipped within 5-12 working days.

Protectin (CD59) Antibody
abx200391-100ug 100 ug
EUR 328
  • Shipped within 2-3 weeks.

Protectin (CD59) Antibody
20-abx225094
  • EUR 370.00
  • EUR 606.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

Protectin (CD59) Antibody
abx231489-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Protectin (CD59) Antibody
20-abx210170
  • EUR 439.00
  • EUR 328.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Protectin (CD59) Antibody
20-abx210424
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

CD59 Rabbit pAb
A12412-100ul 100 ul
EUR 308

CD59 Rabbit pAb
A12412-200ul 200 ul
EUR 459

CD59 Rabbit pAb
A12412-20ul 20 ul
EUR 183

CD59 Rabbit pAb
A12412-50ul 50 ul
EUR 223

CD59 Rabbit mAb
A4090-100ul 100 ul
EUR 410

CD59 Rabbit mAb
A4090-200ul 200 ul
EUR 571

CD59 Rabbit mAb
A4090-20ul 20 ul
EUR 221

CD59 Rabbit mAb
A4090-50ul 50 ul
EUR 287

Normal, chlorophyll-deficient, and flavonoid-deficient pigment isolines of two soybean (Glycine max) cultivars that produced totally different flavonol glycosides (Harosoy produced kaempferol, Clark produced quercetin and kaempferol) had been examined. Plants with larger ranges of complete flavonoids, not particular flavonol glycosides, had been extra UV-B tolerant as decided by progress, pigment, and gas-exchange variables.

Leave a Reply

Your email address will not be published. Required fields are marked *