The complicated microbiome of the rumen capabilities as an efficient system for the conversion of plant cell wall biomass to microbial protein, quick chain fatty acids, and gases. As such, it supplies a singular genetic useful resource for plant cell wall degrading microbial enzymes that could possibly be utilized in the manufacturing of biofuels. The rumen and gastrointestinal tract harbor a dense and complicated microbiome.
To achieve a larger understanding of the ecology and metabolic potential of this microbiome, we used comparative metagenomics (phylotype evaluation and SEED subsystems-based annotations) to look at randomly sampled pyrosequence knowledge from 3 fiber-adherent microbiomes and 1 pooled liquid pattern (a mix of the liquid microbiome fractions from the similar bovine rumens). Even although the Three animals have been fed the similar food plan, the group construction, predicted phylotype, and metabolic potentials in the rumen have been markedly totally different with respect to nutrient utilization.
A comparability of the glycoside hydrolase and cellulosome practical genes revealed that in the rumen microbiome, preliminary colonization of fiber seems to be by organisms possessing enzymes that assault the simply obtainable facet chains of complicated plant polysaccharides and never the extra recalcitrant most important chains, particularly cellulose.
Furthermore, in comparison with the termite hindgut microbiome, there are basic variations in the glycoside hydrolase content material that look like food plan pushed for both the bovine rumen (forages and legumes) or the termite hindgut (wooden).
Digoxin and different cardiac glycosides inhibit HIF-1alpha synthesis and block tumor development.
A library of medicine which can be in scientific trials or use was screened for inhibitors of hypoxia-inducible issue 1 (HIF-1). Twenty medicine inhibited HIF-1-dependent gene transcription by >88% at a focus of 0.Four microM. Eleven of these medicine have been cardiac glycosides, together with digoxin, ouabain, and proscillaridin A, which inhibited HIF-1alpha protein synthesis and expression of HIF-1 goal genes in most cancers cells.
Digoxin administration elevated latency and decreased development of tumor xenografts, whereas remedy of established tumors resulted in development arrest inside one week. Enforced expression of HIF-1alpha by transfection was not inhibited by digoxin, and xenografts derived from these cells have been immune to the anti-tumor results of digoxin, demonstrating that HIF-1 is a important goal of digoxin for most cancers remedy.
Cardiac glycosides are a various household of naturally derived compounds that bind to and inhibit Na+/Ok+-ATPase. Members of this household have been in scientific use for a few years for the remedy of coronary heart failure and atrial arrhythmia, and the mechanism of their constructive inotropic impact is nicely characterised. Exciting latest findings have prompt further signalling modes of motion of Na+/Ok+-ATPase, implicating cardiac glycosides in the regulation of a number of vital mobile processes and highlighting potential new therapeutic roles for these compounds in numerous ailments.
Perhaps most notably, the elevated susceptibility of most cancers cells to those compounds helps their potential use as most cancers therapies, and the first technology of glycoside-based anticancer medicine are presently in scientific trials.
Superior safety in opposition to malaria and melanoma metastases by a C-glycoside analogue of the pure killer T cell ligand alpha-Galactosylceramide.
alpha-Galactosylceramide (alpha-GalCer) is a glycolipid that stimulates pure killer T cells to supply each T helper (Th) 1 and Th2 cytokines. This property permits alpha-GalCer to ameliorate all kinds of infectious, neoplastic, and autoimmune ailments; nonetheless, its effectiveness in opposition to anybody illness is restricted by the opposing actions of the induced Th1 and Th2 cytokines. Here, we report {that a} artificial C-glycoside analogue of alpha-GalCer, alpha-C-galactosylceramide (alpha-C-GalCer), acts as pure killer T cell ligand in vivo, and stimulates an enhanced Th1-type response in mice.
In two illness fashions requiring Th1-type responses for management, particularly malaria and melanoma metastases, alpha-C-GalCer exhibited a 1,000-fold stronger antimalaria exercise and a 100-fold stronger antimetastatic exercise than alpha-GalCer. Moreover, alpha-C-GalCer constantly stimulated extended manufacturing of the Th1 cytokines interferon-gamma and interleukin (IL)-12, and decreased manufacturing of the Th2 cytokine IL-Four in contrast with alpha-GalCer.
Finally, alpha-C-GalCer’s enhanced therapeutic exercise required the presence of IL-12, which was wanted to stimulate pure killer cells for optimum interferon-gamma manufacturing, however didn’t have an effect on IL-4. Overall, our outcomes counsel that alpha-C-GalCer might someday be a wonderful therapeutic choice for ailments resolved by Th1-type responses.
Dividing the giant glycoside hydrolase household 13 into subfamilies: in direction of improved practical annotations of alpha-amylase-related proteins.
Family GH13, also called the alpha-amylase household, is the largest sequence-based household of glycoside hydrolases and teams collectively a quantity of totally different enzyme actions and substrate specificities appearing on alpha-glycosidic bonds. This polyspecificity ends in the undeniable fact that the easy membership of this household can’t be used for the prediction of gene perform based mostly on sequence alone.
In order to determine sturdy teams that present an improved correlation between sequence and enzymatic specificity, now we have carried out a large-scale evaluation of 1691 household GH13 sequences by combining clustering, similarity search and phylogenetic strategies. About 80% of the sequences could possibly be reliably categorised into 35 subfamilies.
ELISA Kit) Human Glycogenin 1 (GYG1)ELISA Kit |
|
201-12-2719 |
SunredBio |
96 tests |
EUR 440 |
- This Glycogenin 1 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
 ELISA Kit) Human Glycogenin 1 (GYG1) ELISA Kit |
|
abx387724-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
 GYG1 Glycogenin-1 Human Recombinant Protein |
|
PROTP46976 |
BosterBio |
Regular: 20ug |
EUR 317 |
|
Description: GYG1 Human Recombinant fused with a 32 amino acid His-T7 tag at N-terminus produced in E.Coli is a single, non-glycosylated, polypeptide chain containing 365 amino acids (1-333 a.a.) and having a molecular mass of 41.2kDa.;The GYG1 is purified by proprietary chromatographic techniques. |
 Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed |
|
ELISA-1 |
Alpha Diagnostics |
1 |
EUR 202 |
, Clone: 3B5) Monoclonal GYG1 / Glycogenin Antibody (clone 3B5), Clone: 3B5 |
|
AMM05275G |
Leading Biology |
0.05mg |
EUR 528 |
|
Description: A Monoclonal antibody against Human GYG1 / Glycogenin (clone 3B5). The antibodies are raised in Mouse and are from clone 3B5. This antibody is applicable in WB and IHC-P, E |
 GYG1 Rabbit pAb |
|
A10218-100ul |
Abclonal |
100 ul |
EUR 308 |
GYG1 Rabbit pAb |
|
A10218-200ul |
Abclonal |
200 ul |
EUR 459 |
GYG1 Rabbit pAb |
|
A10218-20ul |
Abclonal |
20 ul |
EUR 183 |
GYG1 Rabbit pAb |
|
A10218-50ul |
Abclonal |
50 ul |
EUR 223 |
) Glycogenin-1 (Recombinant) |
|
20-abx073518 |
Abbexa |
-
EUR 3766.00
-
EUR 328.00
-
EUR 230.00
|
|
- Shipped within 5-10 working days.
|
 anti-Glycogenin 1 |
|
YF-PA12217 |
Abfrontier |
50 ul |
EUR 363 |
|
Description: Mouse polyclonal to Glycogenin 1 |
anti-Glycogenin 1 |
|
YF-PA12218 |
Abfrontier |
50 ug |
EUR 363 |
|
Description: Mouse polyclonal to Glycogenin 1 |
anti-Glycogenin 1 |
|
YF-PA12219 |
Abfrontier |
100 ug |
EUR 403 |
|
Description: Rabbit polyclonal to Glycogenin 1 |
anti-Glycogenin 1 |
|
YF-PA23854 |
Abfrontier |
50 ul |
EUR 334 |
|
Description: Mouse polyclonal to Glycogenin 1 |
 Recombinant Human Glycogenin-1 |
|
7-02920 |
CHI Scientific |
5µg |
Ask for price |
Recombinant Human Glycogenin-1 |
|
7-02921 |
CHI Scientific |
20µg |
Ask for price |
Recombinant Human Glycogenin-1 |
|
7-02922 |
CHI Scientific |
1mg |
Ask for price |
) Anti-Glycogenin 1 (2C10) |
|
YF-MA13392 |
Abfrontier |
100 ug |
EUR 363 |
|
Description: Mouse monoclonal to Glycogenin 1 |
 with goat anti-rabbit HRP secondary antibody) ExoAb Antibody Kit (CD9, CD63, CD81, Hsp70 antibodies, rabbit anti-human) with goat anti-rabbit HRP secondary antibody |
|
EXOAB-KIT-1 |
SBI |
25 ul each |
EUR 627 |
|
|
) Glycogenin 1 protein (T7 tag) |
|
80R-1855 |
Fitzgerald |
100 ug |
EUR 305 |
|
Description: Purified recombinant Human Glycogenin 1 protein (T7 tag) |
ELISA Kit) Human Glycogenin 2 (GYG2)ELISA Kit |
|
201-12-2720 |
SunredBio |
96 tests |
EUR 440 |
- This Glycogenin 2 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
 ELISA Kit) Human Glycogenin 2 (GYG2) ELISA Kit |
|
abx387725-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
 GYG1 antibody |
|
70R-17662 |
Fitzgerald |
50 ul |
EUR 435 |
|
Description: Rabbit polyclonal GYG1 antibody |
 GYG1 Antibody |
|
1-CSB-PA010070GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
|
|
Description: A polyclonal antibody against GYG1. Recognizes GYG1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB |
 GYG1 siRNA |
|
20-abx902383 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
GYG1 siRNA |
|
20-abx918965 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
GYG1 siRNA |
|
20-abx918966 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
 anti-Glycogenin 2 |
|
YF-PA15978 |
Abfrontier |
50 ul |
EUR 363 |
|
Description: Mouse polyclonal to Glycogenin 2 |
anti-Glycogenin 2 |
|
YF-PA15979 |
Abfrontier |
100 ug |
EUR 403 |
|
Description: Rabbit polyclonal to Glycogenin 2 |
 GYG1 Polyclonal Antibody |
|
27331-100ul |
SAB |
100ul |
EUR 252 |
GYG1 Polyclonal Antibody |
|
27331-50ul |
SAB |
50ul |
EUR 187 |
 GYG1 cloning plasmid |
|
CSB-CL010070HU-10ug |
Cusabio |
10ug |
EUR 390 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1002
- Sequence: atgacagatcaggcctttgtgacactaaccacaaacgatgcctacgccaaaggtgccctggtcctgggatcatctctgaaacagcacaggaccaccaggaggctggtcgtgctcgccacccctcaggtctcagactccatgagaaaagttttagagacagtctttgatgaagtca
- Show more
|
|
Description: A cloning plasmid for the GYG1 gene. |
 anti- GYG1 antibody |
|
FNab03734 |
FN Test |
100µg |
EUR 548.75 |
- Immunogen: glycogenin 1
- Uniprot ID: P46976
- Gene ID: 2992
- Research Area: Metabolism
|
|
Description: Antibody raised against GYG1 |
 Anti-GYG1 antibody |
|
STJ112256 |
St John's Laboratory |
100 µl |
EUR 277 |
|
Description: This gene encodes a member of the glycogenin family. Glycogenin is a glycosyltransferase that catalyzes the formation of a short glucose polymer from uridine diphosphate glucose in an autoglucosylation reaction. This reaction is followed by elongation and branching of the polymer, catalyzed by glycogen synthase and branching enzyme, to form glycogen. This gene is expressed in muscle and other tissues. Mutations in this gene result in glycogen storage disease XV. This gene has pseudogenes on chromosomes 1, 8 and 13 respectively. Alternatively spliced transcript variants encoding different isoforms have been identified. |
 Antibody) Glycogenin 2 (GYG2) Antibody |
|
20-abx116843 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Glycogenin 2 (GYG2) Antibody |
|
abx036618-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
Glycogenin 2 (GYG2) Antibody |
|
abx030300-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Glycogenin 2 (GYG2) Antibody |
|
abx030300-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Glycogenin 2 (GYG2) Antibody |
|
abx233735-100ug |
Abbexa |
100 ug |
EUR 551 |
- Shipped within 5-12 working days.
|
) Anti-Glycogenin 2 (3D10) |
|
YF-MA16601 |
Abfrontier |
100 ug |
EUR 363 |
|
Description: Mouse monoclonal to Glycogenin 2 |
) mRNAExpress mRNA Synthesis kit (5 reactions) |
|
MR-KIT-1 |
SBI |
5 reactions |
EUR 1152 |
- Category: Stem Cell Products
|
) PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1) |
|
PIN320A-KIT |
SBI |
1 Kit |
EUR 4941 |
- Category: PinPoint Integrase Tools
|
) PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1) |
|
PIN340iPS-KIT |
SBI |
1 Kit |
EUR 4941 |
- Category: PinPoint Integrase Tools
|
) PinPoint-FC System for Platform Cell Line Generation & Retargeting (includes PIN300A-1, FC200PA-1, PIN200A-1, PIN510A-1, & PIN600A-1) |
|
PIN300A-KIT |
SBI |
1 Kit |
EUR 2798 |
- Category: PinPoint Integrase Tools
|
) PinPoint-HR System for Platform Cell Line Generation & Retargeting (includes PIN400A-1, PIN200A-1, PIN510A-1, & PIN600A-1) |
|
PIN400A-KIT |
SBI |
1 Kit |
EUR 2798 |
- Category: PinPoint Integrase Tools
|
 Mouse GYG1 shRNA Plasmid |
|
20-abx973868 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
 Rat GYG1 shRNA Plasmid |
|
20-abx986645 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
 GYG1 Polyclonal Conjugated Antibody |
|
C27331 |
SAB |
100ul |
EUR 397 |
 Human GYG1 shRNA Plasmid |
|
20-abx952027 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
) GYG1 Recombinant Protein (Human) |
|
RP014278 |
ABM |
100 ug |
Ask for price |
) GYG1 Recombinant Protein (Rat) |
|
RP204065 |
ABM |
100 ug |
Ask for price |
) PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, GE601A-1, PIN200A-1, PIN510A-1, & PIN600A-1) |
|
PIN410A-KIT |
SBI |
1 Kit |
EUR 4335 |
- Category: PinPoint Integrase Tools
|
) PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, CAS601A-1, PIN200A-1, PIN510A-1, & PIN600A-1) |
|
PIN412A-KIT |
SBI |
1 Kit |
EUR 4335 |
- Category: PinPoint Integrase Tools
|
) T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents) |
|
CAS510A-KIT |
SBI |
1 Kit |
EUR 805 |
|
|
 (Target 1)) Gyg1 sgRNA CRISPR Lentivector (Rat) (Target 1) |
|
K6973602 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 1)) GYG1 sgRNA CRISPR Lentivector (Human) (Target 1) |
|
K0922702 |
ABM |
1.0 ug DNA |
EUR 154 |
 AXYPET STARTER KIT 1 AP-20, AP-200 & AP-1000 WITH ADDITIONAL FREE RACKS OF AXYGEN PIPETTE TIPS |
|
AP-STR-KIT-1 |
CORNING |
1/pk |
EUR 355 |
|
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller |
 Frit Kit |
|
FRIT-KIT |
Next Advance |
1each |
EUR 124 |
|
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool. |
) Rabbit Albumin AssayMax ELISA Kit (Discontinued, replaced by ETA2202-1) |
|
ETA2201-1 |
AssayPro |
96 Well Plate |
EUR 396 |
 (pORF)) Gyg1 ORF Vector (Rat) (pORF) |
|
ORF068023 |
ABM |
1.0 ug DNA |
EUR 506 |
 h GYG1 inducible lentiviral particles |
|
LVP415 |
GenTarget |
1 x107 IFU/ml x 200ul |
EUR 451 |
|
Description: Pre-made optional inducible lentiviral particles for expressing human target: h GYG1 (alternative name: GYG; GSD15), with ORF sequence 100% matching to CDS region in NCBI ID: NM_004130.3. Particles also contains a RFP-Blasticidin dual selection marker. |
 (pORF)) GYG1 ORF Vector (Human) (pORF) |
|
ORF004760 |
ABM |
1.0 ug DNA |
EUR 95 |
 Column Packing Kit |
|
PACK-KIT |
Next Advance |
1pack |
EUR 1035 |
|
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar. |
 Rabbit Albumin AssayMax ELISA Kit |
|
ETA2202-1 |
AssayPro |
96 Well Plate |
EUR 396 |
, Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)) AAVS1 Safe Harbor Targeting Vector 2.0 - All-Purpose Donor (AAVS1-SA-puro-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site) |
|
GE620A-KIT |
SBI |
1 kit |
EUR 2132 |
|
|
, Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)) AAVS1 Safe Harbor Targeting Vector 2.0 - GOI Knock-in Donor (AAVS1-SA-puro-EF1-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site) |
|
GE622A-KIT |
SBI |
1 kit |
EUR 2132 |
|
|
, Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)) AAVS1 Safe Harbor Targeting Vector 2.0 - Reporter Knock-in Donor (AAVS1-SA-puro-MCS-GFP), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site) |
|
GE624A-KIT |
SBI |
1 kit |
EUR 2132 |
|
|
 PCR Mycoplasma Detection Kit |
|
M034-Kit |
TOKU-E |
Kit |
EUR 266 |
 Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit |
|
CAS400A-KIT |
SBI |
1 kit (10 rxn) |
EUR 1110 |
|
|
 CMV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit |
|
CASLV100PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
|
 CMV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit |
|
CASLV105PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
|
 MSCV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit |
|
CASLV120PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
|
 MSCV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit |
|
CASLV125PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
|
 Multiplex gRNA Kit + EF1-T7-hspCas9-H1-gRNA linearized SmartNuclease vector |
|
CAS700A-KIT |
SBI |
10 rxn |
EUR 1132 |
|
|
 Multiplex gRNA Kit + CAG-T7-hspCas9-H1-gRNA linearized SmartNuclease vector |
|
CAS720A-KIT |
SBI |
10 rxn |
EUR 1132 |
|
|
 Multiplex gRNA Kit + CMV-T7-hspCas9-H1-gRNA linearized SmartNuclease vector |
|
CAS740A-KIT |
SBI |
10 rxn |
EUR 1132 |
|
|
) Gyg1 sgRNA CRISPR Lentivector set (Rat) |
|
K6973601 |
ABM |
3 x 1.0 ug |
EUR 339 |
) GYG1 sgRNA CRISPR Lentivector set (Human) |
|
K0922701 |
ABM |
3 x 1.0 ug |
EUR 339 |
-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit) Cas9 Nickase: CMV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit |
|
CASLV200PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
|
-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit) Cas9 Nickase: CMV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit |
|
CASLV205PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
|
-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit) Cas9 Nickase: MSCV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit |
|
CASLV220PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
|
-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit) Cas9 Nickase: MSCV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit |
|
CASLV225PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
|
 Multiplex gRNA Kit + Cas9 Nickase: EF1-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector |
|
CAS750A-KIT |
SBI |
10 rxn |
EUR 1132 |
|
|
 Multiplex gRNA Kit + Cas9 Nickase: CAG-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector |
|
CAS770A-KIT |
SBI |
10 rxn |
EUR 1132 |
|
|
 Multiplex gRNA Kit + Cas9 Nickase: CMV-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector |
|
CAS790A-KIT |
SBI |
10 rxn |
EUR 1132 |
|
|
 and Fast ligase (2.5ul)]) Cas9 SmartNuclease Extra Ligation Kit [includes 5x ligation buffer (10 ul) and Fast ligase (2.5ul)] |
|
CAS9LIG-KIT |
SBI |
1 Kit |
EUR 153 |
|
|
 Anti-Sumo 1 Rabbit Monoclonal Antibody |
|
M00631-1 |
BosterBio |
100ug/vial |
EUR 397 |
|
Description: Rabbit Monoclonal Sumo 1 Antibody. Validated in IP, IF, IHC, WB and tested in Human, Mouse, Rat. |
 Anti-Cytokeratin 1 Rabbit Monoclonal Antibody |
|
M01639-1 |
BosterBio |
100ug/vial |
EUR 397 |
|
Description: Rabbit Monoclonal Cytokeratin 1 Antibody. Validated in WB and tested in Human, Mouse, Rat. |
Most subfamilies seem monofunctional (i.e. include enzymes with the similar substrate and the similar product). The shut examination of the different, apparently polyspecific, subfamilies revealed that they really group collectively enzymes with strongly associated (and even generally nearly equivalent) actions. Overall our subfamily task permits to set the limits for genomic perform prediction on this huge household of biologically and industrially vital enzymes.
ELISA Kit)
ELISA Kit)